Descrição
Amplicon sequencing dataset (Illumina MiSeq) targeting Bacteria (16S ssu rRNA) and Fungi (ITS) in samples (n=110) from soils and aerosol in the McMurdo Dry Valleys and New Zealand.
Versões
A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.
Como citar
Pesquisadores deveriam citar esta obra da seguinte maneira:
Archer S, Maestre F, Maki T, Lee C, Cowan D, Pointing S (2021): Aeolian microbial dispersal limitation to Antarctica (2017). v1.0. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=aeolian_microbes_antarctica&v=1.0
Direitos
Pesquisadores devem respeitar a seguinte declaração de direitos:
O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.
GBIF Registration
Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: 800104b4-cea6-41d7-8944-0fdcca7a7aa8. SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.
Palavras-chave
Metadata
Contatos
- Originador ●
- Usuário ●
- Ponto De Contato
- Originador
- Originador
- Originador
- Originador
- Originador
- Provedor Dos Metadados
Cobertura Geográfica
Antarctica:McMurdo Dry Valleys:Bull Pass, Valley ridge; New Zealand:Glen Eden, Auckland
| Coordenadas delimitadoras | Sul Oeste [-77,519, 161,769], Norte Leste [-36,916, 174,646] |
|---|
Dados Sobre o Projeto
Nenhuma descrição disponível
| Título | Aeolian microbial dispersal limitation to Antarctica (2017) |
|---|---|
| Financiamento | Funding was provided by a grant from the New Zealand Ministry of Business, Innovation & Employment (UOWX1401) and the Yale-NUS College Start-Up Fund. Additional support was given by the European Research Council (BIODESERT project, ERC Grant agreement n° 647038). |
O pessoal envolvido no projeto:
Métodos de Amostragem
Sampling of air mass above the boundary layer for surface influence was achieved by mounting the apparatus in a helicopter with an external sampling port.
| Área de Estudo | Air mass at near-surface (1.5m above ground) and underlying soil was sampled from 11 to 23 January 2017 at valley and elevated locations throughout the Wright Valley, McMurdo Dry Valleys, Antarctica. Comparison samples were taken from the North Island of New Zealand. |
|---|
Descrição dos passos do método:
- Total DNA was directly extracted using a CTAB protocol. DNA yield for these ultra-low biomass samples was quantified using the Qubit 2.0 Fluorometer (Invitrogen) in the range 1.06-8.44ng. Samples were then stored at -20 C. Illumina MiSeq libraries were prepared as per manufacturer’s protocol (Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B; Illumina, San Diego, CA, USA) and with PhiX positive controls. Bacteria and Fungi were targeted with domain-specific PCR primers PCR1 forward (5’ TCGTCGGCAGCGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG 3’) and PCR1 reverse (5’ GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGACTAC HVGGGTATCT AATCC 3’) and the internal transcribed spacer region of fungal 18S and 5.8S rRNA genes: ITS1 forward (5' CTTGGTCATTTAGAGGAAGTAA 3') and ITS2 reverse (5' GCTGCGTTCTTCATCGATGC 3').
Citações bibliográficas
- Archer, S., Lee, K., Caruso, T., Maki, T., Lee, C., Cowan, D., ... & Pointing, S. (2018). Microbial dispersal limitation to isolated soil habitats in the McMurdo Dry Valleys of Antarctica. bioRxiv, 493411. https://doi.org/10.1101/493411
Metadados Adicionais
| Identificadores alternativos | https://ipt.biodiversity.aq/resource?r=aeolian_microbes_antarctica |
|---|