metadata

Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains

Última versión Publicado por SCAR - Microbial Antarctic Resource System en 19 de marzo de 2019 SCAR - Microbial Antarctic Resource System
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.
Fecha de publicación:
19 de marzo de 2019
Licencia:
CC-BY 4.0

Descargas

Descargue la última versión de los metadatos como EML o RTF:

Metadatos como un archivo EML descargar en Inglés (11 kB)
Metadatos como un archivo RTF descargar en Inglés (8 kB)

Versiones

La siguiente tabla muestra sólo las versiones publicadas del recurso que son de acceso público.

¿Cómo referenciar?

Los usuarios deben citar este trabajo de la siguiente manera:

Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4

Derechos

Los usuarios deben respetar los siguientes derechos de uso:

El publicador y propietario de los derechos de este trabajo es SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

Registro GBIF

Este recurso ha sido registrado en GBIF con el siguiente UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2.  SCAR - Microbial Antarctic Resource System publica este recurso, y está registrado en GBIF como un publicador de datos avalado por Scientific Committee on Antarctic Research.

Palabras clave

Metadata

Contactos

¿Quién creó el recurso?:

Bjorn Tytgat
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Ghent
BE
Wim Vyverman
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE
Anne Willems
Professor
Ghent University
9000 Ghent
BE
Elie Verleyen
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE

¿Quién puede resolver dudas acerca del recurso?:

Bjorn Tytgat
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Ghent
BE

¿Quién documentó los metadatos?:

Maxime Sweetlove
assistent researcher
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
1000 Brussels
BE

¿Quién más está asociado con el recurso?:

Proveedor de Contenido
Bjorn Tytgat
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Ghent
BE
Proveedor de Contenido
Elie Verleyen
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE
Proveedor de Contenido
Wim Vyverman
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE
Investigador Principal
Anne Willems
Professor
Ghent University
BE
Proveedor de Contenido
Karolien Peeters
Post doctoral researcher
Ghent University
BE
Zorigto Namsaraev
Post doctoral researcher
Kurchatov Institute

Cobertura geográfica

Sor Ronda Mountains, East Antarctica

Coordenadas límite Latitud Mínima Longitud Mínima [-72,1, 22,7], Latitud Máxima Longitud Máxima [-71,8, 24,6]

Cobertura taxonómica

16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)

Dominio  Bacteria (bacteria)

Cobertura temporal

Fecha Inicial / Fecha Final 2009-01-01 / 2010-01-01

Datos del proyecto

No hay descripción disponible

Título BELDIVA-AMBIO
Fuentes de Financiación This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR).
Descripción del área de estudio The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops.

Personas asociadas al proyecto:

Bjorn Tytgat

Referencias bibliográficas

  1. Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).

Metadatos adicionales

Identificadores alternativos fcef9fcc-f737-46a1-b44e-edde5c5789a2
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils