Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains

Métadonnées uniquement
Dernière version Publié par SCAR - Microbial Antarctic Resource System le mars 19, 2019 SCAR - Microbial Antarctic Resource System
Date de publication:
19 mars 2019
Licence:
CC-BY 4.0

Téléchargez la dernière version de la ressource "Métadonnées uniquement" au format EML ou RTF :

Métadonnées sous forme de fichier EML télécharger dans Anglais (11 KB)
Métadonnées sous forme de fichier RTF télécharger dans Anglais (8 KB)

Description

Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.

Versions

Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.

Comment citer

Les chercheurs doivent citer cette ressource comme suit:

Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4

Droits

Les chercheurs doivent respecter la déclaration de droits suivante:

L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. Ce travail est sous licence Creative Commons Attribution (CC-BY) 4.0.

Enregistrement GBIF

Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : fcef9fcc-f737-46a1-b44e-edde5c5789a2.  SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.

Mots-clé

Metadata

Contacts

Bjorn Tytgat
  • Fournisseur De Contenu ●
  • Créateur ●
  • Personne De Contact
  • Post doctoral assistent
Ghent University
  • Krijgslaan 281
9000 Ghent
BE
Wim Vyverman
  • Fournisseur De Contenu ●
  • Créateur
  • Professor
Ghent University
  • Krijgslaan 281
9000 Ghent
BE
Anne Willems
  • Créateur ●
  • Chercheur Principal
  • Professor
Ghent University
9000 Ghent
BE
Elie Verleyen
  • Fournisseur De Contenu ●
  • Créateur
  • Professor
Ghent University
  • Krijgslaan 281
9000 Ghent
BE
Maxime Sweetlove
  • Fournisseur Des Métadonnées
  • assistent researcher
Royal Belgian Institute for Natural Sciences
  • Rue Vautier 29
1000 Brussels
BE
Karolien Peeters
  • Fournisseur De Contenu
  • Post doctoral researcher
Ghent University
BE
Zorigto Namsaraev
  • Post doctoral researcher
Kurchatov Institute

Couverture géographique

Sor Ronda Mountains, East Antarctica

Enveloppe géographique Sud Ouest [-72,1, 22,7], Nord Est [-71,8, 24,6]

Couverture taxonomique

16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)

Domain Bacteria (bacteria)

Couverture temporelle

Date de début / Date de fin 2009-01-01 / 2010-01-01

Données sur le projet

Pas de description disponible

Titre BELDIVA-AMBIO
Financement This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR).
Description du domaine d'étude / de recherche The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops.

Les personnes impliquées dans le projet:

Bjorn Tytgat

Citations bibliographiques

  1. Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).

Métadonnées additionnelles

Identifiants alternatifs fcef9fcc-f737-46a1-b44e-edde5c5789a2
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils