Téléchargements
Téléchargez la dernière version de la ressource "Métadonnées uniquement" au format EML ou RTF :
Métadonnées sous forme de fichier EML | télécharger dans Anglais (11 kB) |
---|---|
Métadonnées sous forme de fichier RTF | télécharger dans Anglais (8 kB) |
Versions
Le tableau ci-dessous n'affiche que les versions publiées de la ressource accessibles publiquement.
Comment citer
Les chercheurs doivent citer cette ressource comme suit:
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4
Droits
Les chercheurs doivent respecter la déclaration de droits suivante:
L’éditeur et détenteur des droits de cette ressource est SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.
Enregistrement GBIF
Cette ressource a été enregistrée sur le portail GBIF, et possède l'UUID GBIF suivante : fcef9fcc-f737-46a1-b44e-edde5c5789a2. SCAR - Microbial Antarctic Resource System publie cette ressource, et est enregistré dans le GBIF comme éditeur de données avec l'approbation du Scientific Committee on Antarctic Research.
Mots-clé
Metadata
Contacts
Personne ayant créé cette ressource:
Personne pouvant répondre aux questions sur la ressource:
Personne ayant renseigné les métadonnées:
Autres personnes associées à la ressource:
Couverture géographique
Sor Ronda Mountains, East Antarctica
Enveloppe géographique | Sud Ouest [-72,1, 22,7], Nord Est [-71,8, 24,6] |
---|
Couverture taxonomique
16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)
Domain | Bacteria (bacteria) |
---|
Couverture temporelle
Date de début / Date de fin | 2009-01-01 / 2010-01-01 |
---|
Données sur le projet
Pas de description disponible
Titre | BELDIVA-AMBIO |
---|---|
Financement | This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR). |
Description du domaine d'étude / de recherche | The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops. |
Les personnes impliquées dans le projet:
Citations bibliographiques
- Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).
Métadonnées additionnelles
Identifiants alternatifs | fcef9fcc-f737-46a1-b44e-edde5c5789a2 |
---|---|
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils |