metadata

Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains

Versão mais recente publicado por SCAR - Microbial Antarctic Resource System em 19 de Março de 2019 SCAR - Microbial Antarctic Resource System
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.
Publication date:
19 de Março de 2019
License:
CC-BY 4.0

Downloads

Baixe a versão mais recente dos metadados como EML ou RTF:

Metadados como um arquivo EML download em English (11 kB)
Metadados como um arquivo RTF download em English (8 kB)

Versões

A tabela abaixo mostra apenas versões de recursos que são publicamente acessíveis.

Como citar

Pesquisadores deveriam citar esta obra da seguinte maneira:

Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4

Direitos

Pesquisadores devem respeitar a seguinte declaração de direitos:

O editor e o detentor dos direitos deste trabalho é SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License.

GBIF Registration

Este recurso foi registrado no GBIF e atribuído ao seguinte GBIF UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2.  SCAR - Microbial Antarctic Resource System publica este recurso, e está registrado no GBIF como um publicador de dados aprovado por Scientific Committee on Antarctic Research.

Palavras-chave

Metadata

Contatos

Quem criou esse recurso:

Bjorn Tytgat
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Ghent
BE
Wim Vyverman
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE
Anne Willems
Professor
Ghent University
9000 Ghent
BE
Elie Verleyen
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE

Quem pode responder a perguntas sobre o recurso:

Bjorn Tytgat
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Ghent
BE

Quem preencher os metadados:

Maxime Sweetlove
assistent researcher
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
1000 Brussels
BE

Quem mais foi associado com o recurso:

Provedor de Conteúdo
Bjorn Tytgat
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Ghent
BE
Provedor de Conteúdo
Elie Verleyen
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE
Provedor de Conteúdo
Wim Vyverman
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE
Pesquisador Principal
Anne Willems
Professor
Ghent University
BE
Provedor de Conteúdo
Karolien Peeters
Post doctoral researcher
Ghent University
BE
Zorigto Namsaraev
Post doctoral researcher
Kurchatov Institute

Cobertura Geográfica

Sor Ronda Mountains, East Antarctica

Coordenadas delimitadoras Sul Oeste [-72,1, 22,7], Norte Leste [-71,8, 24,6]

Cobertura Taxonômica

16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)

Domínio  Bacteria (bacteria)

Cobertura Temporal

Data Inicial / Data final 2009-01-01 / 2010-01-01

Dados Sobre o Projeto

Nenhuma descrição disponível

Título BELDIVA-AMBIO
Financiamento This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR).
Descrição da Área de Estudo The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops.

O pessoal envolvido no projeto:

Bjorn Tytgat

Citações bibliográficas

  1. Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).

Metadados Adicionais

Identificadores alternativos fcef9fcc-f737-46a1-b44e-edde5c5789a2
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils