Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains

Metadata-only
Последняя версия опубликовано SCAR - Microbial Antarctic Resource System мар. 19, 2019 SCAR - Microbial Antarctic Resource System
Дата публикации:
19 марта 2019 г.
Опубликовано:
SCAR - Microbial Antarctic Resource System
Лицензия:
CC-BY 4.0

Скачайте последнюю версию метаданных ресурса (только метаданные) в формате EML или RTF:

Метаданные в формате EML Скачать в English (11 KB)
Метаданные в формате RTF Скачать в English (8 KB)

Описание

Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.

Версии

В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.

Как оформить ссылку

Исследователи должны дать ссылку на эту работу следующим образом:

Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4

Права

Исследователи должны соблюдать следующие права:

Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. Эта работа находится под лицензией Creative Commons Attribution (CC-BY 4.0).

Регистрация в GBIF

Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2.  SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.

Ключевые слова

Metadata

Контакты

Bjorn Tytgat
  • Content Provider ●
  • Originator ●
  • Point Of Contact
  • Post doctoral assistent
Ghent University
  • Krijgslaan 281
9000 Ghent
BE
Wim Vyverman
  • Content Provider ●
  • Originator
  • Professor
Ghent University
  • Krijgslaan 281
9000 Ghent
BE
Anne Willems
  • Originator ●
  • Principal Investigator
  • Professor
Ghent University
9000 Ghent
BE
Elie Verleyen
  • Content Provider ●
  • Originator
  • Professor
Ghent University
  • Krijgslaan 281
9000 Ghent
BE
Maxime Sweetlove
  • Metadata Provider
  • assistent researcher
Royal Belgian Institute for Natural Sciences
  • Rue Vautier 29
1000 Brussels
BE
Karolien Peeters
  • Content Provider
  • Post doctoral researcher
Ghent University
BE
Zorigto Namsaraev
  • Post doctoral researcher
Kurchatov Institute

Географический охват

Sor Ronda Mountains, East Antarctica

Ограничивающие координаты Юг Запад [-72,1, 22,7], Север Восток [-71,8, 24,6]

Таксономический охват

16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)

Domain Bacteria (bacteria)

Временной охват

Дата начала / Дата окончания 2009-01-01 / 2010-01-01

Данные проекта

Описание отсутсвует

Название BELDIVA-AMBIO
Финансирование This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR).
Описание района исследования The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops.

Исполнители проекта:

Bjorn Tytgat

Библиографические ссылки

  1. Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).

Дополнительные метаданные

Альтернативные идентификаторы fcef9fcc-f737-46a1-b44e-edde5c5789a2
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils