Описание
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.
Версии
В таблице ниже указаны только опубликованные версии ресурса, которые доступны для свободного скачивания.
Как оформить ссылку
Исследователи должны дать ссылку на эту работу следующим образом:
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4
Права
Исследователи должны соблюдать следующие права:
Публикующей организацией и владельцем прав на данную работу является SCAR - Microbial Antarctic Resource System. Эта работа находится под лицензией Creative Commons Attribution (CC-BY 4.0).
Регистрация в GBIF
Этот ресурс был зарегистрирован в GBIF, ему был присвоен следующий UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2. SCAR - Microbial Antarctic Resource System отвечает за публикацию этого ресурса, и зарегистрирован в GBIF как издатель данных при оподдержке Scientific Committee on Antarctic Research.
Ключевые слова
Metadata
Контакты
- Content Provider ●
- Originator ●
- Point Of Contact
- Content Provider ●
- Originator
- Content Provider ●
- Originator
- Metadata Provider
- Content Provider
Географический охват
Sor Ronda Mountains, East Antarctica
Ограничивающие координаты | Юг Запад [-72,1, 22,7], Север Восток [-71,8, 24,6] |
---|
Таксономический охват
16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)
Domain | Bacteria (bacteria) |
---|
Временной охват
Дата начала / Дата окончания | 2009-01-01 / 2010-01-01 |
---|
Данные проекта
Описание отсутсвует
Название | BELDIVA-AMBIO |
---|---|
Финансирование | This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR). |
Описание района исследования | The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops. |
Исполнители проекта:
Библиографические ссылки
- Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).
Дополнительные метаданные
Альтернативные идентификаторы | fcef9fcc-f737-46a1-b44e-edde5c5789a2 |
---|---|
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils |