Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains

Latest version published by SCAR - Microbial Antarctic Resource System on Mar 19, 2019 SCAR - Microbial Antarctic Resource System
Publication date:
19 March 2019
License:
CC-BY 4.0

Download the latest version of the metadata-only resource metadata as EML or RTF:

Metadata as an EML file download in English (11 KB)
Metadata as an RTF file download in English (8 KB)

Description

Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2.

Versions

The table below shows only published versions of the resource that are publicly accessible.

How to cite

Researchers should cite this work as follows:

Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4

Rights

Researchers should respect the following rights statement:

The publisher and rights holder of this work is SCAR - Microbial Antarctic Resource System. This work is licensed under a Creative Commons Attribution (CC-BY 4.0) License.

GBIF Registration

This resource has been registered with GBIF, and assigned the following GBIF UUID: fcef9fcc-f737-46a1-b44e-edde5c5789a2.  SCAR - Microbial Antarctic Resource System publishes this resource, and is itself registered in GBIF as a data publisher endorsed by Scientific Committee on Antarctic Research.

Keywords

Metadata

Contacts

Bjorn Tytgat
  • Content Provider
  • Originator
  • Point Of Contact
Post doctoral assistent
Ghent University
Krijgslaan 281
9000 Ghent
BE
Wim Vyverman
  • Content Provider
  • Originator
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE
Anne Willems
  • Originator
  • Principal Investigator
Professor
Ghent University
9000 Ghent
BE
Elie Verleyen
  • Content Provider
  • Originator
Professor
Ghent University
Krijgslaan 281
9000 Ghent
BE
Maxime Sweetlove
  • Metadata Provider
assistent researcher
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
1000 Brussels
BE
Karolien Peeters
  • Content Provider
Post doctoral researcher
Ghent University
BE
Zorigto Namsaraev
Post doctoral researcher
Kurchatov Institute

Geographic Coverage

Sor Ronda Mountains, East Antarctica

Bounding Coordinates South West [-72.1, 22.7], North East [-71.8, 24.6]

Taxonomic Coverage

16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8–27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536–516)

Domain Bacteria (bacteria)

Temporal Coverage

Start Date / End Date 2009-01-01 / 2010-01-01

Project Data

No Description available

Title BELDIVA-AMBIO
Funding This research was funded by the Special Research Fund BOF of (grant ) and by the Belgian Science Policy Office (BelSPO) projects BELDIVA (EA/00/05), AMBIO (SD/BA/01A) and CCAMBIO (SD/BA/03A). A. Wilmotte is Research Associate of the FRS-FNRS. This study is a contribution to the State of the Antarctic Ecosystem (AntEco) research program of the Scientific Committee on Antarctic Research (SCAR).
Study Area Description The Sop Ronda Mountains (SRM) (22° E-28° E, 71°30′ S-72°40′ S) are a 220 km long, east-west oriented mountain range, situated about 200 km inland, with peaks reaching 3300 m a.s.l. The bedrock is mainly metamorphic (e.g. gneiss) with some plutonic (granite) outcrops.

The personnel involved in the project:

Bjorn Tytgat

Bibliographic Citations

  1. Tytgat, B., Verleyen, E., Sweetlove, M., D'hondt, S., Clercx, P., Van Ranst, E., ... & Vyverman, W. (2016). Bacterial community composition in relation to bedrock type and macrobiota in soils from the Sør Rondane Mountains, East Antarctica. FEMS microbiology ecology, 92(9).

Additional Metadata

Alternative Identifiers fcef9fcc-f737-46a1-b44e-edde5c5789a2
https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils